Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
twitter

Escherichia coli K-12 substr. MG1655 Polypeptide: RbsR DNA-binding transcriptional dual regulator



Gene: rbsR Accession Numbers: EG10819 (EcoCyc), b3753, ECK3747

Synonyms: regulator for rbs operon

Regulation Summary Diagram: ?

Component of: RbsR-ribose

Summary:
The transcription factor RbsR, for "Ribose Repressor," is negatively autoregulated and controls the transcription of the operon involved in ribose catabolism and transport [Mauzy92, Lopilato84, Laikova01]. Transcription of this operon is induced when E. coli is grown in the absence of glucose and when the physiological inducer D-ribose binds to the RbsR repressor [Laikova01, Bell86]. When D-ribose binds to RbsR, the protein becomes inactive because the binding affinity of RbsR decreases [Mauzy92].

RbsR represses not only the rbs operon for transport and utilization of D-ribose but also the de novo synthesis of purine nucleotides from D-ribose 5-phosphate. In the presence of the inducer D-ribose, RbsR activates the salvage pathway of purine nucleotide synthesis [Shimada13a].

Although little is known about the mechanism of regulation of the RbsR transcription factor, Mauzy et al. in 1992 demonstrated that this regulator acts as a repressor by binding to cis-acting elements, which have a conserved inverted repeat sequence and overlap the rbsD promoter [Mauzy92].

RbsR belongs to the GalR/LacI family, which forms a bundle of four helices characteristic of proteins of an HTH DNA contact motif. The C-terminal 270 residues of RbsR are homologous to the ribose-binding protein RbsB

Citations: [Mauzy92a, Burland93]

Gene Citations: [Burland93]

Locations: cytosol

Map Position: [3,936,250 -> 3,937,242] (84.84 centisomes)
Length: 993 bp / 330 aa

Molecular Weight of Polypeptide: 36.612 kD (from nucleotide sequence)

pI: 5.32

Unification Links: ASAP:ABE-0012271 , CGSC:12086 , EchoBASE:EB0812 , EcoGene:EG10819 , EcoliWiki:b3753 , OU-Microarray:b3753 , PortEco:rbsR , PR:PRO_000023686 , Pride:P0ACQ0 , Protein Model Portal:P0ACQ0 , RefSeq:NP_418209 , RegulonDB:EG10819 , SMR:P0ACQ0 , String:511145.b3753 , Swiss-Model:P0ACQ0 , UniProt:P0ACQ0

Relationship Links: InterPro:IN-FAMILY:IPR000843 , InterPro:IN-FAMILY:IPR010982 , InterPro:IN-FAMILY:IPR026909 , InterPro:IN-FAMILY:IPR028082 , Panther:IN-FAMILY:PTHR30146:SF7 , Pfam:IN-FAMILY:PF00356 , Prints:IN-FAMILY:PR00036 , Prosite:IN-FAMILY:PS00356 , Prosite:IN-FAMILY:PS50932 , Smart:IN-FAMILY:SM00354

In Paralogous Gene Group: 30 (25 members)

In Reactions of unknown directionality:

Not in pathways:
D-ribose + RbsR = RbsR-ribose

Gene-Reaction Schematic: ?

Genetic Regulation Schematic: ?

GO Terms:

Biological Process: GO:0045893 - positive regulation of transcription, DNA-templated Inferred from experiment [Shimada13a]
GO:0006351 - transcription, DNA-templated Inferred by computational analysis [UniProtGOA11a]
GO:0006355 - regulation of transcription, DNA-templated Inferred by computational analysis [UniProtGOA11a, GOA01a]
Molecular Function: GO:0000986 - bacterial-type RNA polymerase core promoter proximal region sequence-specific DNA binding Inferred from experiment [Mauzy92]
GO:0001216 - sequence-specific DNA binding bacterial-type RNA polymerase transcription factor activity involved in positive regulation of transcription Inferred from experiment [Shimada13a]
GO:0005515 - protein binding Inferred from experiment [Rajagopala14]
GO:0048029 - monosaccharide binding Inferred from experiment [Shimada13a]
GO:0003677 - DNA binding Inferred by computational analysis [UniProtGOA11a, GOA01a]
GO:0003700 - sequence-specific DNA binding transcription factor activity Inferred by computational analysis [GOA01a]
Cellular Component: GO:0005829 - cytosol Inferred by computational analysis [DiazMejia09]

MultiFun Terms: information transfer RNA related Transcription related
metabolism carbon utilization carbon compounds
regulation genetic unit regulated operon
regulation type of regulation transcriptional level repressor

DNA binding site length: 20 base-pairs

Symmetry: Inverted Repeat

Consensus DNA Binding Sequence: TCAGCGAAACGTTTCGCTGA

Regulated Transcription Units (2 total): ?

Notes:

Essentiality data for rbsR knockouts: ?

Growth Medium Growth? T (°C) O2 pH Osm/L Growth Observations
LB enriched Yes 37 Aerobic 6.95   Yes [Gerdes03, Comment 1]
LB Lennox Yes 37 Aerobic 7   Yes [Baba06, Comment 2]
M9 medium with 1% glycerol Yes 37 Aerobic 7.2 0.35 Yes [Joyce06, Comment 3]
MOPS medium with 0.4% glucose Yes 37 Aerobic 7.2 0.22 Yes [Baba06, Comment 2]

Subunit of: RbsR-ribose

Synonyms: B3753, RbsR

Subunit composition of RbsR-ribose = [D-ribose][RbsR]
         RbsR DNA-binding transcriptional dual regulator = RbsR (extended summary available)

Sequence Length: 330 AAs

Molecular Weight: 36.612 kD (from nucleotide sequence)

Relationship Links: Pfam:IN-FAMILY:PF00356

In Reactions of unknown directionality:

Not in pathways:
D-ribose + RbsR = RbsR-ribose

MultiFun Terms: information transfer RNA related Transcription related
metabolism carbon utilization carbon compounds
regulation genetic unit regulated operon
regulation type of regulation transcriptional level repressor

Regulated Transcription Units (2 total): ?

Notes:


Sequence Features

Feature Class Location Citations Comment
Cleavage-of-Initial-Methionine 1
[Mauzy92, UniProt11]
UniProt: Removed.
Conserved-Region 2 -> 56
[UniProt09]
UniProt: HTH lacI-type;
Chain 2 -> 330
[UniProt09]
UniProt: Ribose operon repressor;
DNA-Binding-Region 4 -> 23
[UniProt10a]
UniProt: H-T-H motif; Non-Experimental Qualifier: by similarity;
Sequence-Conflict 12 -> 13
[Mauzy92, UniProt10]
Alternate sequence: GV → L; UniProt: (in Ref. 1; AAA51477);


Gene Local Context (not to scale): ?

Transcription Unit:

Notes:

History:
10/20/97 Gene b3753 from Blattner lab Genbank (v. M52) entry merged into EcoCyc gene EG10819; confirmed by SwissProt match.


References

Baba06: Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H (2006). "Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection." Mol Syst Biol 2;2006.0008. PMID: 16738554

Bell86: Bell AW, Buckel SD, Groarke JM, Hope JN, Kingsley DH, Hermodson MA (1986). "The nucleotide sequences of the rbsD, rbsA, and rbsC genes of Escherichia coli K12." J Biol Chem 261(17);7652-8. PMID: 3011793

Burland93: Burland V, Plunkett G, Daniels DL, Blattner FR (1993). "DNA sequence and analysis of 136 kilobases of the Escherichia coli genome: organizational symmetry around the origin of replication." Genomics 1993;16(3);551-61. PMID: 7686882

DiazMejia09: Diaz-Mejia JJ, Babu M, Emili A (2009). "Computational and experimental approaches to chart the Escherichia coli cell-envelope-associated proteome and interactome." FEMS Microbiol Rev 33(1);66-97. PMID: 19054114

Gerdes03: Gerdes SY, Scholle MD, Campbell JW, Balazsi G, Ravasz E, Daugherty MD, Somera AL, Kyrpides NC, Anderson I, Gelfand MS, Bhattacharya A, Kapatral V, D'Souza M, Baev MV, Grechkin Y, Mseeh F, Fonstein MY, Overbeek R, Barabasi AL, Oltvai ZN, Osterman AL (2003). "Experimental determination and system level analysis of essential genes in Escherichia coli MG1655." J Bacteriol 185(19);5673-84. PMID: 13129938

GOA01a: GOA, DDB, FB, MGI, ZFIN (2001). "Gene Ontology annotation through association of InterPro records with GO terms."

Joyce06: Joyce AR, Reed JL, White A, Edwards R, Osterman A, Baba T, Mori H, Lesely SA, Palsson BO, Agarwalla S (2006). "Experimental and computational assessment of conditionally essential genes in Escherichia coli." J Bacteriol 188(23);8259-71. PMID: 17012394

Laikova01: Laikova ON, Mironov AA, Gelfand MS (2001). "Computational analysis of the transcriptional regulation of pentose utilization systems in the gamma subdivision of Proteobacteria." FEMS Microbiol Lett 205(2);315-22. PMID: 11750821

Lopilato84: Lopilato JE, Garwin JL, Emr SD, Silhavy TJ, Beckwith JR (1984). "D-ribose metabolism in Escherichia coli K-12: genetics, regulation, and transport." J Bacteriol 158(2);665-73. PMID: 6327616

Mauzy92: Mauzy CA, Hermodson MA (1992). "Structural and functional analyses of the repressor, RbsR, of the ribose operon of Escherichia coli." Protein Sci 1992;1(7);831-42. PMID: 1304369

Mauzy92a: Mauzy CA, Hermodson MA (1992). "Structural homology between rbs repressor and ribose binding protein implies functional similarity." Protein Sci 1992;1(7);843-9. PMID: 1304370

Rajagopala14: Rajagopala SV, Sikorski P, Kumar A, Mosca R, Vlasblom J, Arnold R, Franca-Koh J, Pakala SB, Phanse S, Ceol A, Hauser R, Siszler G, Wuchty S, Emili A, Babu M, Aloy P, Pieper R, Uetz P (2014). "The binary protein-protein interaction landscape of Escherichia coli." Nat Biotechnol 32(3);285-90. PMID: 24561554

Shimada13a: Shimada T, Kori A, Ishihama A (2013). "Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli." FEMS Microbiol Lett 344(2);159-65. PMID: 23651393

UniProt09: UniProt Consortium (2009). "UniProt version 15.8 released on 2009-10-01 00:00:00." Database.

UniProt10: UniProt Consortium (2010). "UniProt version 2010-11 released on 2010-11-02 00:00:00." Database.

UniProt10a: UniProt Consortium (2010). "UniProt version 2010-07 released on 2010-06-15 00:00:00." Database.

UniProt11: UniProt Consortium (2011). "UniProt version 2011-06 released on 2011-06-30 00:00:00." Database.

UniProtGOA11a: UniProt-GOA (2011). "Gene Ontology annotation based on manual assignment of UniProtKB keywords in UniProtKB/Swiss-Prot entries."

Other References Related to Gene Regulation

Zheng04: Zheng D, Constantinidou C, Hobman JL, Minchin SD (2004). "Identification of the CRP regulon using in vitro and in vivo transcriptional profiling." Nucleic Acids Res 32(19);5874-93. PMID: 15520470


Report Errors or Provide Feedback
Please cite the following article in publications resulting from the use of EcoCyc: Nucleic Acids Research 41:D605-12 2013
Page generated by SRI International Pathway Tools version 18.5 on Thu Dec 18, 2014, BIOCYC13A.